Molecular diet studies of water mites reveal prey biodiversity

HCO2198 and LCO1490 primers generate a product of 658 bp in comparison [25]. Prey DNA was also extracted and amplified with the same primers. Control experiments amplified DNA from the legs of mites, which excludes gut tissue. Amplicons were sequenced by Sanger sequencing (GeneWiz, Plainfield, NJ). Next-generation sequencing For next-generation sequencing, DNA extracted from 54 freshly collected water mites, com- prising 21 Lebertia quinquemaculosa, 30 L. davidcooki, 1 Limnesia, and 2 Arrenurus specimens, were amplified with the versions of the mLep and LCO1490 primers tagged with Fluidigm CS1 and CS2 Illumina adapters fused to their 5’ ends, as listed in Table 1 (bottom). Limnesia and Arrenurus were two outgroup water mites chosen to compare with Lebertia but were not the focus of this study. The amplicons were sent to the Michigan State University RTSF Genomics Core for next-generation sequencing on an Illumina MiSeq V2 platform. Specimen-specific index sequences were ligated onto all PCR products, which were purified and sequenced and the resultant quality-filtered fastq files analyzed, as follows: Amplicons were processed to remove dNTPs, primer dimers, and other small side-products (less than 100 bp in size), using the Agencourt AMPure XP system (Beckman). PCR with sample-indexed primers targeting the CS1/CS2 oligos was performed to add dual-indexed, Illumina compatible adapters at the ends of the PCR products. The sample-indexed PCR products were batch-normalized using Invitrogen SequalPrep DNA normalization plates and the recovered products pooled. The

pool was quality-controlled and quantified using a combination of Qubit dsDNA HS, Caliper LabChipGX HS DNA and Kapa Illumina Library Quantification qPCR assays. It was loaded on an Illumina MiSeq v2 standard flow cell and sequenced in a 2x250 bp paired-end format using a v2 500 cycle reagent cartridge. Primers complementary to the Fluidigm CS1/CS2 oligo- nucleotides were added to appropriate wells of the reagent cartridge to act as primers for the forward, reverse and index sequencing reads. Base calling was done by Illumina Real Time Analysis (RTA) v1.18.54, and output of RTA was demultiplexed and converted to FastQ for- mat with Illumina Bcl2fastq v2.19.0. Bioinformatics and statistics FastQ files were demultiplexed using Perl software. Because the left and right paired-end reads covered more than the whole sequence (i.e., the left and right paired reads overlap with one another), the left and right end reads were merged using FLASH (https://ccb.jhu.edu/ software/FLASH/) [26]. The cutoff for a successful merge was set as minimal overlap,10 bp; maximum overlap, 150 bp, minimal mismatch ratio, 0.25; and only those pairs that were suc- cessfully merged were kept for further analysis. Then, assembled sequences were sorted into operational taxonomic unit (OTU) clusters using CD-HIT (http://www.bioinformatics.org/ cd-hit/) [27], with the sequence similarity parameter set to >97% identity to the representative sequence of each OTU cluster. Further analysis was conducted only on clusters represented by

at least 4 sequences. Each OTU was BLASTed (ver 2.6.0+) against the GenBank database Table 1. Primers. Name of Primers Primer Sequence Annealing Temperature Reference mLep LCO1490 5’-CCTGTTCCAGCTCCATTTTC-3’ 5’-GGTCAACAAATCATAAAGATATTGG-3’ 50 �C [23] mLep+TAG LCO1490+TAG 5’-TACGGTAGCAGAGACTTGGTCTCCT GTTCCAGCTCCATTTTC3’ 5’ACACTGACGACATGGTTCTACA GGTCAACAAATCATAAAGATATTGG-3’ 50 �C https://doi.org/10.1371/journal.pone.0254598.t001 PLOS ONE Prey DNA diversity in water mites PLOS ONE | https://doi.org/10.1371/journal.pone.0254598 July 29, 2021 4 / 18