Genetic variability in microbial eukaryotes reshapes marine biodiversity assessment in the age of amplicon sequencing

PLOS One | https://doi.org/10.1371/journal.pone.0326053 June 20, 2025 20 / 29 procedure to identify the exact 18S amplicon sequence variants (ASVs) and their relative read abundances within solitary and colonial specimens belonging to known morphotaxa. ASVs from groups of specimens belonging to the same mor- phospecies were then used to assess intraspecific genetic variability. A phylogenetic tree was constructed from the long- read ASV data as well as reference sequences, and used in conjunction with ASV presences and abundance patterns to infer relationships between morphotaxa. Sample collection Plankton drift net sampling was conducted at and near Station ALOHA (22° 45’N, 158° 00’W) on Hawaiian Ocean Time-series (HOT) cruises 338 and 339 in July–August 2022 and August–September 2022, respectively. Additional net samples were collected on the Simons Collaboration on Ocean Processes and Ecology-PARticles And Growth in the Oce- anic Nutricline (SCOPE-PARAGON II) cruise in August 2022. All cruises took place on the R/V Kilo-Moana. A SEA-GEAR Model 9000 50 cm diameter plankton net with 50μm mesh was deployed for 5-minute intervals to tar- get solitary Nassellaria and Spumellaria. For the larger Collodaria specimens, a 1m diameter net with 1 mm mesh was used. Samples were collected at a depth of ~5m by-hand with a rope, while a double-release opening-closing mechanism enabled additional net sampling at discrete depths (150m and 300m). Immediately upon recovery, samples were examined onboard using a dissecting microscope (Leica MZAPO) with 0.63x

and 1.6x objectives. Individual polycystine radiolarian specimens were photographed, isolated using a Pasteur pipette, and rinsed 3 times in 0.2μm filtered seawater to remove any attached particles, such as prey or other contaminants introduced during net tow sample collection. Specimens were then transferred to 2 ml cryovials with approximately 0.5 ml of 0.2μm filtered seawater and allowed to incubate at room-temperature for ~4 hours to facilitate prey digestion. Cryovials were then frozen at –80˚C onboard and shipped to the University of Southern California on dry ice. In total, 304 isolated specimens were obtained and processed. Sample processing and primer design DNA was extracted from each specimen using the MasterPure Complete DNA and RNA Purification Kit (Biosearch Technologies) following the manufacturer’s instructions for “fluid samples.” The only modifications were: the debris pel- let was retained for taxonomic identification of the specimen’s skeletal remains, and DNA from solitary specimens (i.e., single-cells) was resuspended in 20uL rather than 35uL TE buffer in order to increase DNA concentration for PCR amplifi- cation (Steps 3 and 8 in Part D of the manufacturer’s instructions, respectively). The extracted DNA concentration of each specimen was measured with a Qubit 2.0 fluorometer. Extracted DNA was PCR amplified using three custom primer pairs designed to target ~1450 bp segments of the 18S rRNA gene in either the Nassellaria, Spumellaria, or Collodaria. Targeted primers (Table 2) were developed by manu-

ally inspecting all curated polycystine reference sequences available in the PR2 database v4.14 as well as a long-read environmental DNA sequence database generated by Jamy et al. [56] Using AliView software [68], radiolarian sequences were visually compared to 80% consensus sequences of all other eukaryotic groups in PR2 (at approximately phylum-class level; PR2 taxonomy level 4) to check the specificity of potential primer sequences. Then, primer pair can- didates were tested in-silico using Silva TestPrime 1.0 and the primer test function in PR2 to confirm that relatively few Table 2. Polycystine radiolarian primers designed for this study. Target group Forward primer (5’-3’) Reverse primer (5’-3’) Nassellaria GTCGGTAGTGTATTGGRCTAC CYGCAGGTTCACCTACGG Spumellaria GACGTKTCATTCAAATTTCTGCC GTTACGACTTCTCCTTCCTC Collodaria GGTTGABCCTGCCAGTAG CYTATTGTAGCCCGTGCGC https://doi.org/10.1371/journal.pone.0326053.t002